From Chandra Theesfeld and Daniel Lew, Duke University Medical Center

Method can be usd to generate a PCR fragment with ends homologous to the gene to be disrupted flanking a selectable marker (HIS3, LEU2,TRP1, or URA3 from the pRS vectors of Sikorski and Hieter, 1989).

Forward primer: 5' YFG (40-50 bases) - CGTTTCGGTGATGAC 3' (base number 6 through 20 in pRS vectors)

Reverse primer: 5' YFG (40-50 bases) - TTCCTGATGCGGTATTTTCTCCT 3' (common sequence of vector pRS flanking the selectable marker)

pRS303/313 (HIS3): bases 1424-1401 (PCR product of ca. 1500 bp)
pRS304/314 (TRP1): bases 1238-1215 (PCR product of ca. 1300 bp)
pRS305/315 (LEU2): bases 2475-2452 (PCR product of ca. 2550 bp)
pRS306/316 (URA3): bases 1344-1321 (PCR product of ca. 1400 bp)

Use standard 20-25 µl PCR reaction mixtures (with Taq polymerase) to generate the disruption fragments (enough for at least four yeast transformations).

94C, 4 min
1 cycle

94C, 1 min
52C, 45 sec
72C, 2 min
35 cycles

72C, 4 min
1 cycle

4C hold

Confirm gene disruptants by PCR analysis of transformants' DNA, using one of these primers and a third primer in the gene outside the disruption fragment. Generally, about 20% of the transformants have gene disruptions, comfirmed by PCR.

YFG = Your Favorite Gene

Buffers: